plko gfp
I have a shRNA in my pLKO.1 vector and I would like to clone in a color tag into this vector to track the transduction ... The parent plasmid was pTorA-GFP [7]. ,Plasmid LV-GFP from Dr. Elaine Fuchs's lab contains the insert H2B-GFP and is ... pLKO.1. (Search Vector Database). Backbone size w/o insert (bp) 6380. ,MISSION pLKO.1-puro eGFP shRNA Control Plasmid DNA; To see more application data, protocols, vector maps visit sigma.com/shrna. ,MISSION pLKO.1-puro-CMV-TurboGFP Positive Control Plasmid DNA; ... shRNA to eGFP Control Vector ... MISSION® pLKO.1-puro eGFP shRNA Control . ,Plasmid pLKO.1 GFP shRNA from Dr. David Sabatini's lab contains the insert GFP shRNA and is published in Science. 2008 Jun 13. 320(5882):1496-501. ,Addgene NGS Result AGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTG ... ,Plasmid pLKO.1 puro GFP siRNA from Dr. Bob Weinberg's lab contains the insert GFP siRNA and is published in Cell. 2005 May 6. 121(3):335-48. This plasmid ... ,A variant of pLKO.1 containing an eGFP marker rather than puromycin. Please note that the AgeI site is NOT unique for this vector, so shRNAs should be ... ,Plasmid pLKO.DEST.EGFP from Dr. Ming-Sound Tsao's lab is published in BMC Biotechnol. 2011 Mar 22;11:24. This plasmid is available through Addgene.
| 相關軟體 Multiplicity 資訊 | |
|---|---|
 plko gfp 相關參考資料
How do you clone a fluorescent color tag into pLKO.1 vector?
I have a shRNA in my pLKO.1 vector and I would like to clone in a color tag into this vector to track the transduction ... The parent plasmid was pTorA-GFP [7]. https://www.researchgate.net LV-GFP - Addgene
Plasmid LV-GFP from Dr. Elaine Fuchs's lab contains the insert H2B-GFP and is ... pLKO.1. (Search Vector Database). Backbone size w/o insert (bp) 6380. https://www.addgene.org MISSION® pLKO.1-puro eGFP shRNA Control Plasmid DNA ...
MISSION pLKO.1-puro eGFP shRNA Control Plasmid DNA; To see more application data, protocols, vector maps visit sigma.com/shrna. https://www.sigmaaldrich.com MISSION® pLKO.1-puro-CMV-TurboGFP™ Positive Control ...
MISSION pLKO.1-puro-CMV-TurboGFP Positive Control Plasmid DNA; ... shRNA to eGFP Control Vector ... MISSION® pLKO.1-puro eGFP shRNA Control . https://www.sigmaaldrich.com pLKO.1 GFP shRNA - Addgene
Plasmid pLKO.1 GFP shRNA from Dr. David Sabatini's lab contains the insert GFP shRNA and is published in Science. 2008 Jun 13. 320(5882):1496-501. https://www.addgene.org pLKO.1 GFP shRNA Sequences - Addgene
Addgene NGS Result AGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTG ... https://www.addgene.org pLKO.1 puro GFP siRNA - Addgene
Plasmid pLKO.1 puro GFP siRNA from Dr. Bob Weinberg's lab contains the insert GFP siRNA and is published in Cell. 2005 May 6. 121(3):335-48. This plasmid ... https://www.addgene.org pLKO.3G - Addgene
A variant of pLKO.1 containing an eGFP marker rather than puromycin. Please note that the AgeI site is NOT unique for this vector, so shRNAs should be ... https://www.addgene.org pLKO.DEST.EGFP - Addgene
Plasmid pLKO.DEST.EGFP from Dr. Ming-Sound Tsao's lab is published in BMC Biotechnol. 2011 Mar 22;11:24. This plasmid is available through Addgene. https://www.addgene.org |